Week 3: Analogy/Homology Blog Post

1. Homologous
   a. 1. Dog: These species are carnivorous and usually furry. They were the first domesticated animal            and has been kept and used for many purposes.
       2. Cat: These species are carnivorous mammal and usually furry. They are also domesticated and                    are being loved by many men.
   b. Homologous traits are those that are similar in two different species due to their common ancestors. One homologous trait I am going to identify and analyze is tail on dogs and cats. Tails are the most posterior, or caudal terminal appendage of the vertebral column. The difference in the structure of tails start with the number of vertebrae that makes up the tail. Dogs usually have six to 23 highly mobile vertebrae while cats have maximum of 20. Although both types of tails serves a similar function such as counterbalancing. Cats and Dogs both communicate easily with their tails, but same/similar movements might mean different for both organisms. Dogs also use their tails as rudders while swimming and to spread their distinct scent to the air around them.
   c. The common ancestor of these two organisms must have been a carnivorous mammal that walks on four legs. This is because researchers have been able to trace the ancestral lines of these two organisms by studying the structures, functions, and fossils of past organisms. Their common ancestor would be a mammal with a similar tail.

2. Analogous
   a. 1. Penguin: These species are carnivorous and are a group of aquatic, flightless birds that are highly adapted for life in water.
       2. Whale: These species vary in size and are one of the longest living mammals. Whales can be separated into many suborder such as Odontoceti and Mysticeti.
   b. Analogous traits are those that are similar in two different species due to common environmental pressure, not the genes that are from their common ancestors. The analogous trait I am going to analyze between Penguins and Whales are their flippers. They have developed flippers to assist themselves in swimming under water and moving freely.
   c. We can currently trace back the origins of whales to land-dwelling mammals of the artiodactyl order. As they evolved, their hind limbs became flippers and bodies became more suitable for marine environment. Penguins trace back to birds that could actually fly. They have adapted to the marine environment, and therefore changed their wings into a flappers with small feathers and gained a streamlined body. Because of these evidences, flippers of the whale and penguins are not homologous traits, but analogous traits.

My DNA Code!

Here is my DNA code for translation.

TCCGTATACCACGAGAAAACCGTTAGCGGATTCAAAACCTGCATCACCAGT

Historical Influences On Darwin: Thomas Robert Malthus

1. Many individuals' works and studies prior to Charles Darwin affected his development of the theory of Natural Selection in both positive and negative ways. Out of many works and studies, Essay on the Principle of Evolution by Thomas Malthus has become a cornerstone for Darwin's theory of Natural Selection. Because Darwin had interests in Economics, he noticed Thomas Malthus' work, which said that overpopulation is a real problem that will lead to a famine and destroy the country. From reading about this idea, it occurred to Darwin that animals and plants should also be experiencing the same problem of overpopulation. This curiosity resulted in Darwin starting his studies and developing a theory.

2. Thomas Robert Malthus is most known as a person who provided the starting idea of "survival of the fittest" to Darwin. The central argument of the Essay on the Principle of Evolution lies in two postulates: "That food is necessary to the existence of men," and "that the passion between the sexes is necessary, and will remain nearly in present state." The scientific community can draw two major conclusions from his work. First, the power for species to reproduce is infinitely stronger than the ability for Earth to provide enough resources for men. Second, population, when left alone, increases in geometrical ratio while the number of available resources grow arithmetically. This means that even the slightest difference could result in immense unbalance of numbers. However, with these two conclusions, scientists and researchers need to keep in mind that Malthus made these points by taking his postulates as self-evident, ignoring the possible events or factors that would disrupt the growth ratios of both the population and the resources.
Website: http://www.encyclopedia.com/topic/Thomas_Robert_Malthus.aspx

3. All organisms have the potential of reproducing exponentially.

   -This part of the idea came directly from Thomas Malthus' Essay on the Principle of Evolution. In his work, Malthus explains that population grows in geometrical ratio if left alone with enough resources. 

   What is preventing organisms from reproducing at their potential?

   -Malthus explains that population grows immensely faster than the reproduction of available resources if population is left unchecked. The factors that would prevent organisms from reproducing at their full potential would be instances where the population has to fight for resources, when there is an epidemic, natural disaster, or famine.

    Resources are limited.

   -Because resources grow in arithmetic ratios, it will eventually be caught by exponentially growing population. There are simply not enough resources for every species to reproduce indefinitely on Earth.

4. Charles Darwin's theory of Natural Selection might have not been so developed and well studied without the idea of Thomas Malthus. Thomas Malthus' idea became the cornerstone for Darwin's theory, allowing Darwin to save time thinking about a fresh new idea. Darwin's saved time allowed him to observe more critically and provide with a well tested and thought out theory of Natural Selection. 

5. During Charles Darwin's times, the atmosphere between the Church and the scientists were very tense. This atmosphere was the result of the Enlightenment, an era characterized by dramatic revolutions in science, philosophy, society, and politics. The Church fought against any idea that seemed to conflict with their beliefs and tried to prevent the conflicting ideas from spreading across the world. Their efforts delayed the eventual publication of Darwin's works. In current days, evolution is a widely accepted idea, and while the Church accepts some parts of evolution, it still holds on to their belief of Creationism.