Human Variation & Race

1. Heat negatively impacts the survival of humans by disturbing the homeostasis by forcing us to control the level of water and sodium in our body. There are two kinds of heat: humid and arid. Humid heat is present primarily in Eastern and Southern U.S., in the tropics, and parts of Europe. In this kind of climate, there are large amounts of water vapor and obstructs the evaporation of sweat. In arid climates (Southwestern U.S., Africa, Middle East), the temperatures are relatively high and there are small amount of water vapors. In this dry arid climates, people who work out may have trouble knowing if they are sweating or not because sweat evaporates as soon as it reaches the outer skin. This kind of rapid evaporation of sweat can lead to dehydration and in extreme cases, death.

2. Short term Adaptation: These kinds of adaptation allow organisms to respond quickly to changes in the environment to maintain homeostasis. For example, sweating would be something that would qualify for short term adaptation because humans sweat to cool down their body temperature. By allowing sweat to evaporate, heat transfer to the evaporating sweat and leaves the body. However, sweating for a long time could be dangerous for the body as it can lead to dehydration.

 

  Facultative Adaptation: Facultative traits are genetic traits. Our skin color can be a facultative adaptation to heat stress. Lighter colored skin means that people living in that climate does not require much protection against the UV rays and have opted out to absorb more Vitamin D. Dark colored skin provides better protection against the UV rays but gives up the better ability to absorb Vitamin D.
 




Developmental Adaptation: These adaptations are traits developed by changing the DNA over a long period of time. Our response to heat includes bipedalism. While standing on two feet, we are exposed to less heat from the sun because we have less surface area that is showing to the sun. In addition, standing allows our skin to have more contact with breezes by exposing a lot of surface area.
 






Cultural Adaptation: Cultural adaptations vary between cultures, but they can also work together. One very obvious cultural adaptation would be the usage of air conditioners to bring the temperature lower than the outside. We love to cool off next to an air conditioner when the outside temperature is higher than 110 F.






3. By studying variation in human adaptation to the heat, we can figure out what to do in certain climates. We know how to deal with the heat; we avoid it, tolerate it, or embrace it. We have invented air conditioners, fans, and made bright clothing, shading structures, and swimming pools to survive the heat. We know that we have to stay hydrated as much as possible and avoid being hurt by the heat.

4. I believe that the variations of adaptations to the heat is due to the difference in race because it is the environment that affects the adaptations. People from a certain race will adapt according to the environment when they are sent to different parts of the world, not according to their race. Environment is the factor that affect adaptations made by humans.

Language Blog

Part 1: You were asked to engage in a conversation for 15 minutes where you were not allowed to use any version of a symbolic language (no speaking, writing, or ASL).

   Trying to communicate with my sister without using symbolic language was very difficult until I started using body language. Because my sister knows me well, we were able to communicate with ease by only using body language. Most of our conversation would be like me posing/gesturing and then my sister asking me if what she thinks is right. Most of the times she was right, and we were able to act out what I wanted to do.
   Because I know the experience might be different with other individuals, I decided to go talk to one of my neighbors. In this case, my neighbor was confused because I was just using body languages and decided to give up talking to me and ask me what is wrong. My neighbor has a different perspective on many things because we come from different cultures and environment.
   With my first conversation, I had the control of the conversation because she would analyze my body language easily and reply to them. By knowing me and having the same cultural experience, I was able to control the flow of the conversation and change topics whenever I wanted to. However, with my neighbor, because he had trouble understanding my body language, he started asking me yes or no questions. From then on, he had the control of the conversation and decided to stop after thinking the conversation was pointless.
   If I imagine that me and my partner in the conversation represent two different cultures, one that uses spoken language and one that does not, I believe the one who uses spoken language will have the advantage in communicating complex ideas within their population. This is because in body language (Not ASL), pointing to my face could mean many different things such as "me," "face," "I," etc. By speaking, we have words that symbolizes certain object/idea/events. Spoken language is more precise and efficient than body language in talking about discussing food plans for winter/causation for illness, weather and other ideas that cannot be shown in pictures.
   I believe that people from the speaking culture will think that they are far more superior than the other culture that does not speak. Because people from the speaking culture still uses body language and is sometimes more effective and important than spoken language, people who speak will be able to somewhat understand the body languages while those who do not speak will not be able to comprehend spoken language.
   An example of modern day situation of this conflict can be found among the deaf/mute. Because they cannot use the spoken language, they often have to write their thoughts out to continue a conversation. This can be quite annoying as writing is a much slower process than speaking.

Part 2: You were asked to spend 15 minutes communicating without any physical embellishments, i.e., no hand signals, not vocal intonation, not head, facial, or body movements.

   In this part of the experiment, I totally failed in holding up any type of conversations. I tried communicating with my parents and my friends, but the whole time I was talking, no one was interested in the topic after a while. I was told that I sound like a machine trying to talk because I talked in monotone and did not make any movements. My parents were patient enough to listen to 7 minutes of me talking and after that, just went into their rooms. My friends, on the other hand, told me to be quiet and left me out of the conversation after 3 minutes. With the lack of tone/body language, nothing was interesting and I failed to hold up a good conversation.
   As explained in part 1, I believe that people from speaking culture utilizes body language in their everyday conversation. Dr. Albert Mehrabian conducted several studies on nonverbal communication and concluded that only 7% of and message is conveyed through words, 38% by vocal elements, and 55% through body language (nonverbal elements). This means that although we use words everyday to hold up a conversation, must of our conversations are done by body language. For example, in America, we keep our distances of about 3 to 5 feet away from talking to strangers. By someone talking to you in that distance range, you already know that the person is not quite comfortable talking to you yet. Another example might be something like crossing your arms and leaning back while talking to somebody. This posture could mean that you are mad/frustrated with the target audience. By reading a person's body language, we are sometimes able to analyze and understand the mood/thoughts of the person.
   Being able to read body languages is an adaptive behavior and can have multiple benefits for the person. For example, when you see someone constantly looking around and being anxious at the bank, you might believe something is wrong with that person. If the security notices this behavior, they are able to keep an eye on that persons behavior and act as fast possible if the person shows any signs of committing criminal activity. The security's attention to these body languages could possibly save everyone in the bank from imminent danger.
   Although I cannot think about anyone who have difficulties reading body language, I know that cultures differ in the symbols of the body language. For example, in some Mediterranean countries such as Brazil and Turkey, an O,K, hand sign is an insult. If you are raised in Brazil and some tourists give you an O.K. sign for approval, you can be very offended by misjudging their body language because of cultural perspectives. In this case, reading body language is actually a negative trait and is unreliable.

Piltdown Hoax Blog Post

Piltdown Hoax might be labeled as one of the most influential and groundbreaking false discovery in the world of science. During the 1910s, the search for the evidence of connection between the apes and human was very intense. In the midst of the heat, early in 1912, amateur archaeologist Charles Dawson found a jawbone that seemed like belonging to an ancient human skull. He contacted and invited England’s leading archaeologist, Arthur Smith Woodward, and French archaeologist Pierre Teilhard de Chardin to the little village of Piltdown, where the first discovery of the jawbone was made. The trio, excited to share their discovery, explained that the jawbone that was discovered shows the connection between the apes and humans. Amazed by the new discovery, scientists believed that England also has human fossils like others, and in addition, that England’s human ancestors might be the oldest out of any ancestors. Also, the new found jawbone supported the idea of humans developing a bigger brain before beginning to walk on two legs. Later on, the trio found more fossils at the village and silenced all remaining skeptics. For the next decade, the model of Piltdown man dominated research on human evolution although no more Piltdown man fossils were discovered after Charles Dawson died. Scientists had started to begin to discover ancient fossils of human ancestors in other continents that seemed to conflict with the Piltdown foundings. Because the scientists did not have the proper tools and knowledge, they were not able to explain the difference in Piltdown discoveries and the fossils from other continents. After World War II, scientists could roughly estimate the date of the fossils by measuring the fluorine content in fossils. In 1949, scientists conducted the fluorine test and found out that the fossil was not that old. In 1953, scientists launched the full-scale analysis of the Piltdown fossils and discovered that the fossils were actually forged, not formed by human ancestors.

Although scientists are curious, creative, and persistent by nature, they are still human, and that brings in room for faults to impact the scientific process. For example, this Piltdown Hoax was planned simply out of jealousy of Charles Dawson. Because Britain was unable to find significant fossils of their human ancestors while other countries such as Germany was discovering many fossils and becoming known as the birthplace of men. This negatively impacted the scientific process by unnecessarily forging fake evidence to feel proud and slowing down other possible discoveries. In addition, another human fault is gullibility. Excited that Britain finally found a fossil of human ancestor, naive British scientists believed in the Piltdown discoveries until 40 years later, where evidences from many other continents seemed to go directly against the discoveries. It wasn't until 1949, when the authenticity of the discovery was called into question. This could have been avoided by simply scrutinizing the discoveries and finding out that the wear in the canine teeth was backwards.

With the ability to study the fluorine content left in the rocks/fossils, scientists were able to estimate the date of those discoveries made. This technique of fluorine dating positively affected the scientific processes by allowing scientists to answer unsolved questions. By using this technique, they were able to discover that the discoveries made in Piltdown was fake, and that human “bones” had chronic acid stains and iron solution alterations to make the bones look older than it is.

I believe that it is impossible to remove the “human” factor from science to reduce the chance or errors. This is because the “humanness” is what feeds the curiosity of human and the desire to discover and answer unsolved questions. Without the “human” factor, we wouldn't even be questioning the world. Because humans have such great determination for wanting to be the first to discover something new, I believe that the humanness in science will never disappear. However, it is possible to prevent events such as the Piltdown Hoax from happening again to us by learning from our mistakes. As humans, we are able to study and learn from the mistakes we made and make sure that the mistake does not happen again. Tools like Scientific Method allows us to reduce the human error and prevent such hoaxes from happening because scientists do not accept ideas or experiments that have not been tested for validity. Through the scientific method, we make sure that the idea is true by being able to repeat the experiments and getting the same results that prove that some idea is correct. I would personally not want to remove the human factor from science because removing human factor would be the same thing as removing the desire to advance and make progress in life. By removing this desire, all we would do is make discoveries and do nothing about it.

The lesson I learned from learning about this event is to prove that some new ideas or discoveries are valid by being able to test the experiment repeatedly and seeing if the results are all supporting the idea. When receiving unverified information from others, I will make sure that their reasoning and explanations are valid and sound before letting their ideas impact my other ideas.

Comparative Primate Blog Post

1. Lemurs 

     Lemurs are primates that belong to the Order Primates and Suborder Strepsirhini. They live only on the island of Madagascar and adjacent islands off the east coast of Africa. They are called arboreal, which means that they live in trees, but they do come down to the floor once in a while. Because they are very adaptable to their environment, they live everywhere, including the rainforests and hot/dry areas.

     Lemurs have a unique derived trait called a "dental comb" formed by forward projecting lower incisors and canines. As heterodents, their dental formula is , which means that they have 2 incisors, 1 canine, 3 premolars, and 3 molars. Their bottom incisors and canine teeth provides grooming and feeding for the organism. They groom with their teeth to get rid of debris in their furs and excess hair. Because Lemurs live in an environment with trees, most of them are herbivores and they have developed projecting lower incisors and canines to be able to open seeds and eat other plants. Although most Lemurs are herbivores, some are omnivores that eat insects, eggs, and lizards. Because of their omnivores feeding, their premolars have become sharp to assist them in eating insects.

2. Spider Monkey

     Spider Monkeys are part of the group called the New World Monkeys, and are one of the three major informal groups of the biological Order Primates. They live in the rainforests of Central and South America in the highest part of the rainforest canopies. Like the Lemurs, Spider Monkeys are arboreal, which means that they live in the trees.

     New World Monkeys have the dental formula of , which means that they have 2 incisors, 1 canine, 3 premolars, and 3 molars. As they live in the trees, they are naturally safe from land predators. Because they are arboreal, they eat plants, seeds, insects, and lizards. But it is interesting to see them not eating small prey despite their sharp canine teeth. I assume this is because they do not want to hunt for small preys on the ground due to the possible dangers of predators.

3. Baboon

     Baboons belong to the group of Old World Monkeys, also known as the Family Cercopithecidae. They reside on the main continent of Africa. Unlike their tree-dwelling counterparts, this organism is highly adaptable and can live in a variety setting. Because of their diverse habitat, their diet may differ from eating plants and seeds to small quantities of meat, such as antelope and fish.

     Baboons have the dental formula is , consisting of 2 incisors, 1 canine, 2 premolars, and 3 molars. Unlike the past two organisms analyzed, Baboons differ by having only 2 premolars. Although I was unable to find enough resources to explain this, I am guessing this is because their jaws are not big enough to carry the third premolar. Humans have the same problem, as many take out their third premolar, commonly known as the "wisdom tooth," to prevent their jaws from being deformed and disoriented. I believe they have sharper teeth built for eating meat because it may be hard to find plants and seeds on a dessert of Africa. 

4. Gibbon

     Gibbons are known as the Lesser Ape, and belong to the Family Hylobatidae. They are currently considered endangered and inhabit the subtropical rainforests. They are arboreal, meaning that they live on the trees and diets have been fit to match their habitat.

     This organism has the dental formula of , same as the Baboon. With 2 incisors, 1 canine, 2 premolars, and 3 molars, they eat mostly fruits. The environment is able to provide abundance of fruits for the Gibbons, and because of this, Gibbons are mostly herbivores. Like the Baboons, I believe that they do not have the third premolar because of the orientation and the size of the jaw. 

5. Chimpanzee

     Unlike the Gibbons, Chimpanzees are known as the Great ape, and belong to the Family Hominidae. While Lesser Apes are relatively small in size and weight, Great Apes are big and heavy. They are native to Africa including Guinea to Western Uganda and Tanzania. They also inhabit rainforests and grassy lands of the Savannah.

     Chimpanzees have the dental formula that is the same with Gibbons and Baboons. Having a very sharp canine teeth, they are able to prey on creatures like birds and occasionally, on other monkeys. With the molars and premolars, they are able to eat ripe fruit and small insects. Their dental orientation and size are the closest to human, and because of this, they have a wide variety of diet. 

Conclusion: Looking at five different categories of Primates, I was able to see the effects of the environment on to the organisms. These organisms develop distinct dental formulas for better chance of survival in their habitat. Herbivores such as Lemurs and Spider Monkeys will have one more premolar to aid them on eating plants, seeds, and insects. Omnivores such as Baboons, Gibbons, and Chimpanzees lose one premolar because they have very sharp canine teeth to prey on small organisms. Because they do not eat on seeds and little insects as much as the first two organism, they do not have an extra premolar. If the organism lives on the trees, most of them will be eating plants and insects while others will add on meat to their diet. It will be interesting to see additional effects of the environment other than the differences in the dental orientation of the organisms.

Week 3: Analogy/Homology Blog Post

1. Homologous
   a. 1. Dog: These species are carnivorous and usually furry. They were the first domesticated animal            and has been kept and used for many purposes.
       2. Cat: These species are carnivorous mammal and usually furry. They are also domesticated and                    are being loved by many men.
   b. Homologous traits are those that are similar in two different species due to their common ancestors. One homologous trait I am going to identify and analyze is tail on dogs and cats. Tails are the most posterior, or caudal terminal appendage of the vertebral column. The difference in the structure of tails start with the number of vertebrae that makes up the tail. Dogs usually have six to 23 highly mobile vertebrae while cats have maximum of 20. Although both types of tails serves a similar function such as counterbalancing. Cats and Dogs both communicate easily with their tails, but same/similar movements might mean different for both organisms. Dogs also use their tails as rudders while swimming and to spread their distinct scent to the air around them.
   c. The common ancestor of these two organisms must have been a carnivorous mammal that walks on four legs. This is because researchers have been able to trace the ancestral lines of these two organisms by studying the structures, functions, and fossils of past organisms. Their common ancestor would be a mammal with a similar tail.

2. Analogous
   a. 1. Penguin: These species are carnivorous and are a group of aquatic, flightless birds that are highly adapted for life in water.
       2. Whale: These species vary in size and are one of the longest living mammals. Whales can be separated into many suborder such as Odontoceti and Mysticeti.
   b. Analogous traits are those that are similar in two different species due to common environmental pressure, not the genes that are from their common ancestors. The analogous trait I am going to analyze between Penguins and Whales are their flippers. They have developed flippers to assist themselves in swimming under water and moving freely.
   c. We can currently trace back the origins of whales to land-dwelling mammals of the artiodactyl order. As they evolved, their hind limbs became flippers and bodies became more suitable for marine environment. Penguins trace back to birds that could actually fly. They have adapted to the marine environment, and therefore changed their wings into a flappers with small feathers and gained a streamlined body. Because of these evidences, flippers of the whale and penguins are not homologous traits, but analogous traits.

My DNA Code!

Here is my DNA code for translation.

TCCGTATACCACGAGAAAACCGTTAGCGGATTCAAAACCTGCATCACCAGT

Historical Influences On Darwin: Thomas Robert Malthus

1. Many individuals' works and studies prior to Charles Darwin affected his development of the theory of Natural Selection in both positive and negative ways. Out of many works and studies, Essay on the Principle of Evolution by Thomas Malthus has become a cornerstone for Darwin's theory of Natural Selection. Because Darwin had interests in Economics, he noticed Thomas Malthus' work, which said that overpopulation is a real problem that will lead to a famine and destroy the country. From reading about this idea, it occurred to Darwin that animals and plants should also be experiencing the same problem of overpopulation. This curiosity resulted in Darwin starting his studies and developing a theory.

2. Thomas Robert Malthus is most known as a person who provided the starting idea of "survival of the fittest" to Darwin. The central argument of the Essay on the Principle of Evolution lies in two postulates: "That food is necessary to the existence of men," and "that the passion between the sexes is necessary, and will remain nearly in present state." The scientific community can draw two major conclusions from his work. First, the power for species to reproduce is infinitely stronger than the ability for Earth to provide enough resources for men. Second, population, when left alone, increases in geometrical ratio while the number of available resources grow arithmetically. This means that even the slightest difference could result in immense unbalance of numbers. However, with these two conclusions, scientists and researchers need to keep in mind that Malthus made these points by taking his postulates as self-evident, ignoring the possible events or factors that would disrupt the growth ratios of both the population and the resources.
Website: http://www.encyclopedia.com/topic/Thomas_Robert_Malthus.aspx

3. All organisms have the potential of reproducing exponentially.

   -This part of the idea came directly from Thomas Malthus' Essay on the Principle of Evolution. In his work, Malthus explains that population grows in geometrical ratio if left alone with enough resources. 

   What is preventing organisms from reproducing at their potential?

   -Malthus explains that population grows immensely faster than the reproduction of available resources if population is left unchecked. The factors that would prevent organisms from reproducing at their full potential would be instances where the population has to fight for resources, when there is an epidemic, natural disaster, or famine.

    Resources are limited.

   -Because resources grow in arithmetic ratios, it will eventually be caught by exponentially growing population. There are simply not enough resources for every species to reproduce indefinitely on Earth.

4. Charles Darwin's theory of Natural Selection might have not been so developed and well studied without the idea of Thomas Malthus. Thomas Malthus' idea became the cornerstone for Darwin's theory, allowing Darwin to save time thinking about a fresh new idea. Darwin's saved time allowed him to observe more critically and provide with a well tested and thought out theory of Natural Selection. 

5. During Charles Darwin's times, the atmosphere between the Church and the scientists were very tense. This atmosphere was the result of the Enlightenment, an era characterized by dramatic revolutions in science, philosophy, society, and politics. The Church fought against any idea that seemed to conflict with their beliefs and tried to prevent the conflicting ideas from spreading across the world. Their efforts delayed the eventual publication of Darwin's works. In current days, evolution is a widely accepted idea, and while the Church accepts some parts of evolution, it still holds on to their belief of Creationism.